Pim2 on oluline dna kahjustuse vastuse reguleerimiseks hulgimüeloomirakkudes verevähi ajakiri

Pim2 on oluline dna kahjustuse vastuse reguleerimiseks hulgimüeloomirakkudes verevähi ajakiri

Anonim

Õppeained

  • Vähiravi

Abstraktne

Moloney viiruse (PIM) pärssimise integreeritud integreerimine hulgimüeloomi (MM) korral vähendab testitud inimeselt saadud MM-rakuliinide raku elujõulisust ja vähendab kasvajate koormust ksenotransplantaadi hiiremudelites, muutes PIM-id haiguse oluliseks terapeutiliseks sihtmärgiks. PIM kinaasi inhibiitoreid testitakse praegu kliiniliselt MM-iga. Otsisime erinevate PIM-ide rolli MM-is. Meie andmed näitavad, et Pim2-l on oluline roll MM-rakkude tsütotoksilisuses. Meie andmed tõendavad Pim2 uut rolli DNA kahjustuste vastuse (DDR) reguleerimisel. Pim2 mahajätmine ülesreguleerib mitmeid allavoolu DDR-markereid, imiteerides MM-rakkude ravi doksorubitsiiniga (Dox) ja nähes kinaasi rolli selle raja negatiivse regulaatorina. Doxi indutseeritud DNA kahjustused põhjustavad Pim2 taseme langust, asetades kinaasi otse Doxi-DNA seondumiskohast allavoolu. Pim2 üleekspressioon annab antioksütootilise toime kaudu Doxi vastu kerge ellujäämise eelise, rõhutades veelgi selle olulisust DDR-i rajas. Need andmed annavad ülevaate PIM-kinaasi aktiivsuse uudsest mehhanismist ja pakuvad raamistikku terapeutiliste lähenemisviiside kavandamiseks MM-is.

Sissejuhatus

Moloney viiruse (PIM) kinaaside proviraalsed integratsioonid on seriin-treoniini kinaasid, millel on hiljuti näidatud mitmekülgne ja oluline roll paljude hematoloogiliste pahaloomuliste kasvajate tekkes ja progresseerumises. 1, 2 hulgimüeloomi (MM) korral hõivavad nad olulise kinaaside kihi, mis soodustavad vähirakkude vohamist ja kaitsevad apoptoosi eest. 3 PIM kinaasi perekond koosneb kolmest seriini-treoniini kinaasi isovormist; PIM1, 2 ja 3, mis on vähirakkudes põhiliselt aktiivsed. 4 PIM kinaaside translatsiooni soodustab JAK-STAT (Januse kinaasi / signaali muundurid ja transkriptsiooni aktivaatorid) ja NF-κB (tuumafaktor-KB) radade tsütokiinide vahendatud aktiveerimine, põhjustades PIM ekspressioonitaseme tõusu MM-rakud, kui nad on kultiveeritud luuüdi stroomaraku (BMSC) sektsiooniga. 3 Interleukiin-6 (IL-6) sekreteeritakse BMSC-de kaudu mikrokeskkonda ja see aktiveerib ST-rakkude raku MM-rakkudes, et soodustada PIM transkriptsiooni. 3 MM-rakkudes toimivad PIM-id prospektiivsuse faktoritena Bcl-2-ga seotud rakusurma (BAD) fosforüülimiseks ja apoptoosi vältimiseks. 5 PIM2 soodustab veelgi rakkude proliferatsiooni, imetades rapamütsiini kompleksi 1 aktiivsuse imetaja sihtmärki (TSC2) aktiivselt pärssivalt ja põhjustades selle dissotsieerumist rapamütsiini kompleksi 1 imetaja sihtmärgiga. 6 PIM pärssimine põhjustab fosforüülitud 4EBP1 (eukarüootse translatsiooni alustamise faktor) langust 4E-siduv valk 1), samuti MCL1 ja c-MYC taseme langus. 3 PIM inhibeerimine on näidanud kinaaside rolli rakutsükli peatamises ja apoptoosis rakukultuuris, samas kui ksenotransplantaadi hiiremudelis on täheldatud MM-i tuumori koormuse vähenemist. Hoolimata kasvavast huvist nende kinaaside kui terapeutiliste molekulaarsete sihtmärkide vastu, on MM-ravi kliinikus üllatav puudus väikeste molekulide inhibiitoritest. Inhibiitorid, mis on juba varem jõudnud MM-i kliinilistesse uuringutesse, on olnud pan-PIM inhibiitorid, millel on erinevat efektiivsust iga isovormi sihtimisel. 4, 8 Selles uuringus püüdsime selgitada välja iga PIM-isovormi erinevad rollid ja seda tehes saada paremini aru, milline sihtimisviis oleks MM-i ravis kõige olulisem.

materjalid ja meetodid

Reaktiivid

Bortesomiib ja doksorubitsiin (Dox) osteti firmalt Selleck Chemicals LLC (Houston, TX, USA).

MM rakuliinid

MM-rakuliinid U266 ja RPMI-8226 osteti ettevõttelt American Type Culture Collection (Rockville, MD, USA). Dr Steven Rosen (Loodeülikool, Chicago, IL, USA) esitas deksametasoonitundlikud (MM1.S) ja deksametasoonresistentsed (MM1.R) inimese rakuliinid. Melfalaanresistentsed (LR5) ja doxi suhtes resistentsed RPMI-Dox40 (Dox40) rakuliinid tarnis dr William Dalton (H Lee Moffitt Cancer Center, Tampa, FL, USA). OPM1 ja OPM2 rakud saadi firmalt Dr P Lief Bergsagel (Mayo kliinik, Scottsdale, AZ, USA). ANBL6 WT ja ANBL6 velkaadresistentsed (ANBL6-VR) rakud tarnis dr Robert Orlowski (MD Andersoni vähikeskus, Houston, TX, USA) ja INA-6 rakud dr Renate Burger (Kieli ülikool, Keil, Saksamaa) ). Rakuliine kasvatati RPMI-1640 söötmes, mis sisaldas 10% veise loote seerumit (Gibco, Life Technologies, Carlsbad, CA, USA), 2 μml-glutamiini, 100 U / ml penitsilliini ja 100 μg / ml streptomütsiini (Gibco). ANBL6 rakke kasvatati 20% veise loote seerumis, lisades 2, 5 ng / ml IL-6 (VR-rida kultiveeriti bortesomiibiga 1 nm / ml). INA-6 rakke kasvatati ka 2, 5 ng / ml IL-6 (R&D Systems, Minneapolis, MN, USA).

Mononukleaarsete rakkude eraldamine ja patsiendi proovide töötlemine

Mononukleaarsete rakkude saamiseks töödeldi erinevates haiguse staadiumides MM-i patsientidelt kogutud luuüdi proove Ficoll-Paque (GE Healthcare, Boston, MA, USA) gradiendiga. Seejärel sorteeriti need rakud CD138 + ja CD138-fraktsioonideks magnetiliste helmeste eraldamise teel (MACS eralduskolonnid; Miltenyi Biotec, Cambridge, MA, USA) ja säilitati kuivade külmutatud graanulitena edasiseks analüüsiks. Osa rakkude negatiivsest fraktsioonist plaaditi ja kasvatati α-MEM söötmes, milles oli 20% veise loote seerumit, 2 μm / ll-glutamiini, 100 U / ml penitsilliini ja 100 μg / ml streptomütsiini (Gibco, Life Technologies ). Neid rakke hoiti kultuuris kuni 2 kuud ja neid kasutati BMSC sektsioonina in vitro kokultuuriuuringutes. Kõigi patsiendi proovide jaoks saadi teadlik nõusolek vastavalt Helsingi deklaratsioonile ja Massachusettsi üldhaigla institutsionaalse ülevaate nõukogu heakskiidul.

Western blot

MM-rakud koguti ja lüüsiti, nagu eelnevalt mainitud. Seejärel mõõdeti 9 lüsaati valgu kvantitatiivseks määramiseks, keedeti (100 ° C 5 minutit), töötati naatriumdodetsüülsulfaat-polüakrüülamiidi geelelektroforeesil 4–15% gradiendigeelidega 110 V juures (Bio-Rad, Hercules, CA, USA), viidi üle nitrotselluloosmembraanidele ja immunoblotiseeriti järgmiste antikehadega: pCHK2 (Thr68), pCHK1 (Ser345), pH2AX (Ser139), PIM1, PIM2, PIM3, kaspaas-3, PARP, BAD, pBAD (Ser112), p21 Waf1 / Cip1, MDR-1, pYAP1 (Ser127), YAP1, ABL1 ja GAPDH (Cell Signaling, Beverly, MA, USA), mida kasutati laadimiskontrolliks. Kõik antikehad lahjendati 1: 1000 5% veise seerumi albumiini / TBST-ga (TBS pluss Tween-20).

Rakkude elujõulisuse testid

Pan-PIM-kinaasi inhibiitori AZD1208 ja Doxi ning üksikute kinaaside löökide ja sissetungide mõju MM-rakuliinide püsimajäämisele analüüsiti MTT (3- (4, 5-dimetüülmetasool-2-üül)) mõõtmise teel -2, 5, difenüültetranaatriumbromiid; Chemicon International, Temecula, CA, USA) värvuse neeldumine, nagu eespool kirjeldatud. 9 MM1.S rakku raputati kolmes eksemplaris tihedusega 20 000–30 000 rakku süvendi kohta 96-augulistel plaatidel (Costar, Cambridge, MA, USA) söötmega ja AZD1208 või Dox erineva kontsentratsiooniga 24, 48 ja 72 h temperatuuril 37 ° C.

RNA ekstraheerimine ja kvantitatiivne PCR

MM-rakuliinide kogu RNA eraldati ja puhastati RNeasy Mini Kit-iga (Qiagen, Hilden, Saksamaa) vastavalt tootja spetsifikatsioonidele. Seejärel sünteesiti cDNA pöördtranskriptsiooni abil ja amplifitseeriti seejärel geenispetsiifiliste praimerite paaridega, nagu eespool kirjeldatud. 9 Kasutatavad inimese kvantitatiivsed PCR praimerid on järgmised: PIM1 F, 5′-GAGTGGATCCGCTACCATCG-3 'ja PIM1 R, 5'-GGCCCCTGATGATCTCTTCG-3'; PIM2 F, 5'-AGGGATTGAGGATCAGGGGT-3 'ja PIM2 R, 5'-CACAGGTTCTGGGAGGAAGG-3'; PIM3 F, 5'-GACCCTGACTTTCTCCTGCG-3 'ja PIM3 R, 5'-CCAGCGTTCAAAAGGCACTC-3'; GAPDH F, 5'-ACTGTGGATGGCCCCTCCGG-3 'ja GAPDH R, 5'-GCAGCGCCAGTAGAGGCAG-3' (Life Technologies).

Rakutsükli analüüs ja apoptoosi tuvastamine

MM-rakuliinid (1 x 106 rakku) kasvatati 24 ja 48 tundi ainult 10% RPMI söötmes või AZD1208 erinevate kontsentratsioonidega ning koristati ja analüüsiti apoptoosi suhtes anneksiin V / PI värvimiskomplektiga (BD Biosciences, San Diego, CA, USA) nagu eespool kirjeldatud. 9

Transfektsioon ja lentivirusnakkus

PIM kinaaside rolli paremaks hindamiseks MM-rakuliinides kasutati U266, MM1.S, RPMI ja Dox40 rakkudes kinaaside lükamiseks lühikest juuksenõela RNA-d ja väikest segavat RNA-d (siRNA). Mööduv transfektsiooni vahendatud siRNA knockdown viidi läbi MM1.S ja U266 rakkudes, kasutades Amaxa Cell Nucleofector Kit (Lonza, Basel, Šveits). Krüpteerimise kontrollina kasutati inimese On-Target Plus siRNA PIM1, PIM2 ja PIM3 jaoks ning On-Target Plus sihtrühmata siRNA (Dharmacon, Lafayette, CO, USA). Indutseeritavad PIM2 lühikeste juuksenõeltega RNA löögid klooniti pLKO-Tet-ON plasmiididesse (Addgene, Cambridge, MA, USA) järgmiste PIM2 praimeritega: F, 5′-CCGGCCAGGATCTCTTTGACTATATCTCGAGATATAGTCAAAGAGATCCTGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATTATÖÖTAMINE, PTA2 Life Technologies). PIM2 lühikese juuksenõelaga RNA või pLKO.1 kontrollplasmiidid transfekteeriti koos pVSV-G ja delta 8.9 plasmiidiga FUGENE 6 transfektsioonireaktiiviga 293 T-rakkudesse (Roche, Indianapolis, IN, USA). Seejärel koguti viirus 48/72 h ja kanti spinokulatsiooni teel MM-rakuliinidele. Löömine indutseeriti doksütsükliini manustamisega annuses 100 ng / ml (Selleck Chemicals).

Statistiline analüüs

Esitatud andmete usaldusväärsuse tagamiseks viidi kõik katsed laboris läbi vähemalt kolm korda. Elujõulisuse testid viidi igas andmepunktis läbi kolmes eksemplaris ja standardhälve kanti graafikusse vea protsendina. Lisaks tehti kõigi graafikute jaoks Studenti T- testid, et hinnata erinevuste statistilist olulisust minimaalse olulisusega P <0, 05. Kogu statistiline analüüs viidi läbi Excelis.

Tulemused

PIM kinaasid on olulised sihtmärgid MM-is

Esmalt otsisime välja, kas PIM-kinaasid olid olulised ravieesmärgid MM-is. Kõiki kolme PIM kinaasi ekspresseeriti patsiendist saadud CD138 + rakkudes. Kahe erineva MM-iga patsiendi kvantitatiivne PCR ja western blot-analüüs näitasid PIM ekspressiooni väga sarnaseid mustreid: täheldati suuremat PIM1 / 2/3 taset CD138 + rakkude fraktsioonis ja PIM2 märkimisväärselt suuremat ekspressiooni võrreldes kahe teise isovormiga ( Joonis 1a). Neid andmeid kinnitas veel viie patsiendi proovikomplekti Western blot analüüs ning see viitab PIM2 ainulaadselt olulisele rollile MM-is, võrreldes PIM1 / 3-ga. Kolme kinaasi ekspressiooniprofiil inimese MM-rakuliinide ridades kinnitas, et neid ekspresseeriti kõigis MM-rakuliinides, kusjuures PIM2 / 3 valkude ekspressioon oli märkimisväärselt suurem osa rakuliinidest, muutes kinaasid rakendatavateks in vitro uuring (joonis 1b). Asano jt. 3 on näidanud BMSC sektsiooni väga tugevat rolli PIM kinaaside aktiveerimise reguleerimisel MM-is. Seda kinnitas MM1.S, mida kultiveeriti patsiendil saadud BMSC-dega 24 ja 48 tundi (joonis 1c). PIM kinaasi taset reguleeriti nii otsese kui ka kaudse kokkupuute korral BMSC-dega, viidates nii adhesiooni kui ka tsütokiinide rollile selle stroomaraku / MM-raku interaktsiooni vahendamisel. 10 Nagu varasemates uuringutes näidatud, oli IL-6 ja insuliini kasvufaktori-1 (IGF-1) manustamine 24 ja 48 tunni jooksul kinaaside BMSC-laadse aktiveerimise esilekutsumiseks piisav (joonis 1d). 11 Täpsemalt nähti, et IL-6 on tõhusam vahendaja, reguleerides kõiki kolme kinaasi ülesreguleerimisel 24 tunni pärast ja mõningal määral 48 tunni möödudes, samal ajal kui IGF-1 ravi mõjutas PIM taseme tõusu 24 tunni pärast, mis oli vähenenud 48 tunni pärast.

Image

PIM kinaasid on olulised sihtmärgid MM-is. ( a ) mõõdeti Pim1, 2 ja 3 mRNA ja valgu ekspressiooni MM-patsientide CD138 + ja CD138-rakkudes. Kõik kolm PIM kinaasi ekspresseeruvad kõrgemalt CD138 + rakkudes (* P <0, 01, ** P <0, 001, *** P <0, 0001, kasutades t- testi). ( b ) PIM kinaasi valgu ekspressiooni algtasemes mõõdeti inimese MM-rakuliinide Western blot analüüsi abil. Need kolm kinaasi ekspresseeruvad suuremas osas testitud MM-rakuliinides. ( c ) MM1.S rakke kultiveeriti otse või kaudselt insuldi kaudu patsiendi päritolu luuüdi stroomarakkudega 24 ja 48 tundi ja blotiseeriti PIM kinaasi ekspressiooniks. MM1.S rakkudel oli kinaaside suurem ekspressioon BMSC-dega kultiveerimisel. ( d ) MM1.S rakke kasvatati 24 ja 48 tundi IL-6 (10 ng / μl) ja IGF-1 (50 ng / μl) juuresolekul ja blotiseeriti Pimi kinaasi ekspressiooniks. Nii IL-6 kui ka IGF-1 kutsusid esile PIM kinaasi ekspressiooni.

Täissuuruses pilt

PIM kinaasid on MM-ist funktsionaalselt erinevad

PIM1 / 2/3 üksikud mööduvad löögid MM1.S rakkudes siRNA transfektsiooni abil aitasid kolme isovormi funktsionaalselt eraldada. Ainuüksi PIM2 koputamisel oli oluline mõju rakkude ellujäämisele 24. ja 48. tunnil pärast transfektsiooni ning seda peeti ainsaks isovormiks, mis oli seotud apoptootilise raja aktiveerimisega (joonis 2), samas kui PIM1 ja 3 ei põhjustanud apoptoosi (andmed ei ole näidatud). PIM2 raputamine MM1.S rakkudes andis kõige nähtavama mõju raku elujõulisusele (nähtav 48 tunni pärast), kinnitades veel kord oma varem väljakujunenud rolli apoptoosi kaudsel ennetamisel BAD fosforüülimise kaudu (joonis 2b). 12 kaspaas-3 ja PARP-i lõhustumist nähti PIM2 koputamise tulemusel juba 24 tunni pärast Western-blot analüüsi abil (joonis 2b).

Image

PIM kinaasid on funktsionaalselt erinevad. ( a ) Kõigi kolme kinaasi mööduv löömine viidi läbi MM1.S rakkudes ja mõõdeti Western blot analüüsi abil. MTT elujõulisuse testid viidi läbi 24 ja 48 tundi pärast transfektsiooni. Pim2 knockdown (KD) põhjustab rakkude elujõulisuse kõige olulisema languse MM1.S rakkudes 48 tunni pärast ( P = 3, 23 × 10 −5, kasutades t- testi). ( b ) Pim2 siRNA-ga transfekteeritud rakke blotiseeriti ka apoptoosimarkerite suhtes 24 tunni pärast. Pim2 KD põhjustab PARP ja kaspaas-3 lõhustumise ning seob rakud apoptoosi juba 24 tunni pärast. Samuti nähti, et fosforüülitud BAD väheneb Pim2 KD-ga 24 tunni pärast.

Täissuuruses pilt

PIM2 osaleb DDRi represseerimises

Varasemad uuringud on seostanud PIM kinaasid DNA kahjustuse vastuse (DDR) raja vahendamisega teistes pahaloomulistes kasvajates. 13 PIM2 üksik mööduv löömine MM1.S rakkudes põhjustas mitmete DDR-markerite fosforüülimise, sealhulgas pCHK1, pCHK2, pH2AX ja P21, mis viitab PIM2 rollile selle raja ülesvoolu regulaatorina (joonis 3a). 14 Selle DNA kahjustuste analüüsi funktsionaalse kontrollina analüüsiti MM1.S rakkudes Doxi-ravi mõju samadele markeritele. Dox on DNA-d kahjustav aine, mis seob end otse kaheahelalise DNA-ga, et käivitada DDR aktiveerimine. 15 Doksiini manustamine poole maksimaalse inhibeeriva kontsentratsiooni korral reguleeris pCHK1, pCHK2 ja pH2AX juba 24 tundi pärast töötlemist MM1.S-ga, jäljendades PIM2 löögi mõju (joonis 3b). Huvitav on see, et PIM2 valgu tase langes Dox-raviga, mis viitab sellele, et PIM2 asub otse DNA kahjustuskohast allavoolu ja toimib ATM / ATR-st ülesvoolu (ataksia telangiektaasia-muteeritud / ATM- ja RAD3-seotud). Tundub, et see regulatiivne roll piirdub PIM2-ga, kuna PIM1 / 3 tasemed ei muutunud töödeldud rakkudes muutumatuna.

Image

Pim 2 on seotud MM-i DDR-rajaga. ( a ) Pim2 mööduv KD MM1S-rakkudes viidi läbi siRNA transfektsiooni teel. Rakud koguti 24 tundi pärast transfekteerimist ja Western blot määrati DDR-markerite jaoks. Pim2 KD põhjustab CHK1, CHK2 ja H2AX suurenenud fosforüülimist. ( b ) MM1.S rakke töödeldi Doxiga (200 ja 400 nm) ja koguti Western blot analüüsi jaoks 24 tunni jooksul. MM1.S-rakkude töötlemine Doxiga põhjustab Pim2 ekspressiooni vähenemist ja sellest tulenevalt DDR-i sihtmärkide saavutamist 24 tunni pärast (samal ajal kui Pim1 ja 3 jäävad muutumatuks). ( c ) Doxi vahendatud DNA kahjustusi analüüsiti täiendavalt Dox40 ja RPMI rakkudes. Rakke kasvatati 24 ja 48 tundi Doxi töötlemisel lainepikkusel 200 ja 400 nm ja koguti Western blot analüüsiks. Resistentse rakuliini dox-ravi Dox40 ei muuda Pim2 ekspressiooni ja allavoolu sihtmärgid jäävad muutumatuks. ( d ) Pim2 koputati Dox40 rakkudesse lühikese juuksenõelaga RNA (shRNA) kaudu ja rakke analüüsiti pCHK1, pCHK2 ja kaspaas-3 ekspressiooniks Western blot analüüsi abil. Ainuüksi Pim2 koputamisest piisas DDR-raja aktiveerimiseks Dox40 rakkudes.

Täissuuruses pilt

Et teha kindlaks, kas nende DDR-markerite aktiveerimine sõltus PIM2 taseme langusest, analüüsiti rada Dox-resistentsetes rakkudes. RPMI-8226 ja Dox40 rakke töödeldi Doxiga ja hinnati DDR raja aktiveerumist 24 ja 48 tunni pärast. Huvitav on see, et rada aktiveerus RPMI rakkudes, mis on tundlikud Doxi ravi suhtes. PIM2 tasemed vähenesid ja ülejäänud markerite fosforüülimine suurenes. Lisaks nähti Dox-ravi alguses mõju PIM2 tasemele ja rakke ei lõhustatud Caspase-3-ga kuni 48-tunnise ajahetkeni, eraldades Pim2 rolli sellel teel oma varasemast rollist apoptootiliste ainete vahendamisel. rada MM-rakkudes. Teise võimalusena jäid PIM2 tasemed Dox40 rakkudes muutumatuks koos ülejäänud DDR-raja valkudega. PIM2 ühekordne suunatud indutseeritav löök Dox40 rakuliinist oli piisav, et mõjutada fosforüülitud DDR-markerite suurenemist ja mööda minna rakkude MDR-1-vahendatud resistentsuse rada (joonis 3d), kuna PIM2 aktiivsus on Doxi / DNA otsesest seondumisest allpool . Need tulemused kinnitasid taas sõltuvust PIM2 taseme langusest DDR-i markerite allavoolu aktiveerimisel. Sarnased testid viidi läbi kasutades y-kiiritamise vahendatud DNA kahjustusi ja täheldati PIM2 taseme tõusu. See ei ole üllatav, arvestades γ-kiirguse toimemehhanisme DDR-i aktiveerimisel rühmitatud ühe- või kaheahelaliste katkestuste abil, 18 mis on Doxi vahendatud DDR-ist väga erinev mehhanism 19, ja lisaks võib oletada, et PIM2 roll DDR-i aktiveerimise vahendamisel on dünaamiline, sõltuvalt induktsiooni režiimist (andmeid pole näidatud).

Eksogeensel PIM2 aktiveerimisel on erinev erinevus MM-rakkude ellujäämisel

MM-rakuliinid, mis ei ekspresseeri endogeenselt kõrge Pim2 taset, nakatati lentiviiruse PIM2 sisselogimisega , et selle funktsionaalset olulisust täiendavalt kinnitada, kasutades funktsiooni suurendamise (GOF) mudelit (joonis 4a). PIM kinaase peetakse MM-rakkude prosurvivaliteguriteks 3 ja me tahtsime seda tõdemust oma sissesüsteemis kinnitada. Rakkude elulemust mõõdeti rea elujõulisuse testidega. Algseisus ei olnud sissetungivad rakud paremad kui nende kontroll. Kuid Doxi-ravi ajal oli sissepritses RPMI rakkudes annusest sõltuval viisil 72 tunni jooksul kerge ellujäämise eelis (joonis 4b). PIM2 sissetungimise funktsionaalse efekti selgitamiseks Dox-resistentses süsteemis viidi GOF Dox40 rakkudes läbi samad elujõulisuse testid kui nende kontrollrakkudel (joonis 4b). Huvitav on see, et Dox40 GOF-rakkude sama töötlemine muutis nende resistentsuse osaliselt Doxi suhtes (vaadeldav 48 ja 72 tunni ajapunktides). DDR-i rada sissetõmbejoontes analüüsiti Western blot analüüsi abil 24 ja 48 tunni jooksul Doxi töötluse ajal. Fosforüülitud CHK1, CHK2 ja H2AX olid kõik ülesreguleeritud nii RPMI kui ka Dox40 GOF rakkudes (joonis 4c). Pärast töötlemist 400 nm Dox-iga vähenes PIM2 tase mõlemas rakuliinis veidi pärast 24 tundi.

Image

Pim2 eksogeensel ekspressioonil on erinev erinevus MM-rakkude ellujäämisel. ( a ) Pim2 GOF viidi läbi PIM2 sissetõmmatava plasmiidi lentiviiruse infektsiooni abil RPMI ja Dox40 rakkudes ja visualiseeriti Western blot analüüsiga algtasemel. GOF-liinide elujõulisust hinnati MTT kaudu 24, 48 ja 72 tundi pärast nakatamist. ( b ) RPMI ja Dox40 GOF-i ja kontroll-rakuliini töödeldi Doxiga (lainepikkusel 50, 200, 400 ja 1000 nm) ja elujõulisust hinnati MTT abil 24, 48 ja 72 h. ( c ) RPMI / Dox40 GOF rakke töödeldi 200 ja 400 nm Doxiga ning blottides DDR-i ja apoptoosi markerite jaoks 24 ja 48 tundi pärast töötlemist. * P <0, 01, ** P <0, 001 ja *** P <0, 0001, kasutades t- testi.

Täissuuruses pilt

Arutelu

Iga järgneva uuringuga on PIM kinaasidel tõestatud, et neil on MM vähirakkude mehhanismi reguleerimisel väga erinevaid funktsioone. Selle uuringu tulemused illustreerivad PIM2 aktiivsuse dünaamilist olemust ja kinnitavad veelgi selle olulisust MM-rakkude ellujäämisel. PIM kinaasid on patsiendi luuüdi CD138 + fraktsioonis ülesreguleeritud ja PIM2 nähti vähi sektsioonis kolmest kinaasist kõige kõrgemalt ekspresseeritud. PIM kinaasid ekspresseeritakse veelgi MM-rakuliinides, muutes need in vitro uuringute hõlpsaks objektiks. PIM kinaasi ekspressioon aktiveeritakse BMSC juuresolekul ja täpsemalt IL-6 ja vähemal määral IGF-la lisamisega. PIM kinaaside üksik mööduv löömine MM1.S rakkudes osutas PIM2 erilisele tähtsusele rakkude ellujäämisel. Pim2 mööduv löömine suurendas veelgi CHK1, CHK2 ja H2AX fosforüülimist. Pan-PIM pärssimise tulemusel aktiveerus pATR, mis viitab sellele, et PIM2 surub maha DDR-i raja aktiveerimise ATR-modulatsiooni kaudu ja võib kaudselt takistada DDR-i vahendatud apoptoosi. MM1.S-rakkude dox-ravi näitas lisaks DDR aktiveerimisele ka PIM2 taseme langust, mis viitab PIM2 rollile otse DNA kahjustuse järel (Doxi sidumissait). PIM2 koputus taastas lisaks DDR-i aktiveerimise Dox-resistentsetes Dox40 rakkudes, tugevdades selle piisavust DDR-i aktiveerimiseks.

Ehkki PIM2 üleekspressioon ei mõjutanud raku aktiivset proliferatsiooni algtasemel, andis Dox-ravi ajal RPMI rakkudele osalise ellujäämise eelise. See uuringukomplekt mitte ainult ei selgita PIM2 potentsiaalselt uut rolli DDR-raja vahendamisel, vaid võib ka selgitada praeguste pan-PIM-i inhibiitorite ebaefektiivsust kliinikus. PIM2 funktsioon MM-is on mitmetahuline ja dünaamiline. Ilma selle kõigi rollide põhjaliku mõistmiseta on keeruline kohandada ravimit, mis võib tõhusalt põhjustada rakusurma, ilma et oleks vaja alternatiivset rada teatud määral vastupanu osutada.

Käimasolevate uuringute eesmärk on mõista PIM2 ja ATM / ATR vahelise koostoime aluseid. Kasulik oleks kindlaks teha, kas PIM2 seostub nende valkudega otse, et mõjutada nende inaktiveerimist ja kas PIM2 LOF-i keskkonnas on mingi funktsionaalne kattumine PIM1 ja PIM3-ga. Need uuringud aitavad paremini mõista PIM-kinaaside pärssimisviisi, võimaldades selle klassi ravimite ratsionaalset kavandamist MM-i ravis.